View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3445-Insertion-17 (Length: 233)
Name: NF3445-Insertion-17
Description: NF3445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3445-Insertion-17 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 8 - 233
Target Start/End: Original strand, 43689966 - 43690191
Alignment:
| Q |
8 |
attttgaagaaaaatgggtaagagaagaaggaaacaacaaaaactactattatgttttaaagtccaaaatcggagaaggttctttttccacagtgtggaa |
107 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43689966 |
attttgaagaaaaattggtaagagaagaaggaaacaacaaaaactactattatgttttaaagtccaaaatcggagaaggttctttttccacagtgtggaa |
43690065 |
T |
 |
| Q |
108 |
agctgaacaaagaccaagtggtgaagatgtagcggtgaagcaagtctttctctccaaactcaactctcacctcagagcttccttggactgtgagatcaac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43690066 |
agctgaacaaagaccaagtggtgaagatgtagcggtgaagcaagtctttctctccaaactcaactctcacctcagagcttccttggactgtgagatcaac |
43690165 |
T |
 |
| Q |
208 |
tttttgtcttctgttaatcatcctaa |
233 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
43690166 |
tttttgtcttctgttaatcatcctaa |
43690191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University