View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3445_high_17 (Length: 250)
Name: NF3445_high_17
Description: NF3445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3445_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 12 - 237
Target Start/End: Original strand, 40883886 - 40884111
Alignment:
| Q |
12 |
gtgatttacaatgaaattaccctctcacaatctaccgatttcttttttgtttgttcatataaattagttaatcttcattatcaattgccaaaaatttcat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40883886 |
gtgatttacaatgaaattaccctctcacaatctaccgatttcttttttgtttgttcatataaattagttaatcttcattatcaattgccaaaaatttcat |
40883985 |
T |
 |
| Q |
112 |
gaccattgccaaaaatctcaccacaaaaatgaccctccacaatattgatgcaatgcatgccgtgcttacttttgnnnnnnnnaaggaataaattaacgtg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
40883986 |
gaccattgccaaaaatctcaccacaaaaatgactctccacaatattgatgcaatgcatgccgtgattacttttgttttttttaaggaataaattaacgtg |
40884085 |
T |
 |
| Q |
212 |
ttttttgattttgtgactgtgtgtct |
237 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40884086 |
ttttttgattttgtgactgtgtgtct |
40884111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 8 - 106
Target Start/End: Complemental strand, 8890640 - 8890542
Alignment:
| Q |
8 |
tttggtgatttacaatgaaattaccctctcacaatctaccgatttcttttttgtttgttcatataaattagttaatcttcattatcaattgccaaaaat |
106 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8890640 |
tttggtgatttacgatgaaattaccctctcacaatctaccaatttcttttttgtttgttcatataaattagttaatcttcattatcaattgccaaaaat |
8890542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 116 - 183
Target Start/End: Complemental strand, 8890553 - 8890484
Alignment:
| Q |
116 |
attgccaaaaatctcaccacaaaaat--gaccctccacaatattgatgcaatgcatgccgtgcttacttt |
183 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
8890553 |
attgccaaaaatctcaccacaataatatgaccctccaaaatattgatgcaatgcctgccgtgcttacttt |
8890484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 6e-18; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 48 - 110
Target Start/End: Complemental strand, 41475169 - 41475107
Alignment:
| Q |
48 |
gatttcttttttgtttgttcatataaattagttaatcttcattatcaattgccaaaaatttca |
110 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
41475169 |
gatttcttttttgtttgtccatataaattgattaatcttcataatcaattgccaaaaatttca |
41475107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 47 - 110
Target Start/End: Original strand, 33358818 - 33358881
Alignment:
| Q |
47 |
cgatttcttttttgtttgttcatataaattagttaatcttcattatcaattgccaaaaatttca |
110 |
Q |
| |
|
|||||||| || ||||||| |||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
33358818 |
cgatttctgttctgtttgtccatataaattgattaatcttcataatcaattgccaaaaatttca |
33358881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 116 - 167
Target Start/End: Complemental strand, 41475122 - 41475071
Alignment:
| Q |
116 |
attgccaaaaatctcaccacaaaaatgaccctccacaatattgatgcaatgc |
167 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||||||| || ||||||||| |
|
|
| T |
41475122 |
attgccaaaaatttcaccaaataaatgaccctccacaatcttcatgcaatgc |
41475071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 47 - 110
Target Start/End: Original strand, 10209086 - 10209149
Alignment:
| Q |
47 |
cgatttcttttttgtttgttcatataaattagttaatcttcattatcaattgccaaaaatttca |
110 |
Q |
| |
|
||||||||||| ||||||| |||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
10209086 |
cgatttcttttctgtttgtccatataaattgattaatcttcataatcaattgccaaaaatttca |
10209149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 48 - 110
Target Start/End: Complemental strand, 48117958 - 48117896
Alignment:
| Q |
48 |
gatttcttttttgtttgttcatataaattagttaatcttcattatcaattgccaaaaatttca |
110 |
Q |
| |
|
|||||||||| ||| ||| |||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
48117958 |
gatttcttttctgtctgtccatataaattgattaatcttcataatcaattgccaaaaatttca |
48117896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University