View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3445_high_5 (Length: 349)
Name: NF3445_high_5
Description: NF3445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3445_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 185 - 322
Target Start/End: Complemental strand, 52593420 - 52593283
Alignment:
| Q |
185 |
aatcatgaggcagtagtatgtctctctttattttgtcctttttaaaaaagtctgtgatcatgaaatgattatgatggggtagtagtatattatttgtgcg |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52593420 |
aatcatgaggcagtagtatgtctctctttattttgtcctttttaaaaaagtctgtgatcatgaaatgattatgatggggtagtagtatattgtttgtgcg |
52593321 |
T |
 |
| Q |
285 |
tgatagaaggtaatctctttgtaataataatacatgag |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52593320 |
tgatagaaggtaatctctttgtaataataatacatgag |
52593283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 52593597 - 52593472
Alignment:
| Q |
1 |
gtggtcggtctttctttttgtttgaaattaaaaacatatactctctgttgttggagttgccatttgtctctccttccttcttcaaactggattcataatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52593597 |
gtggtcggtctttctttttgtttgaaattaaaaacatatactctctgttgttggagttgccatttgtctctccttccttcttcaaactggattcataatt |
52593498 |
T |
 |
| Q |
101 |
ctctattgcacctctgcttgctctgg |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
52593497 |
ctctattgcacctctgcttgctctgg |
52593472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University