View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3445_high_8 (Length: 298)
Name: NF3445_high_8
Description: NF3445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3445_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 7 - 282
Target Start/End: Complemental strand, 2588271 - 2587996
Alignment:
| Q |
7 |
ttcgttccctgttggccaccatggtggaggaatgccgctttccaaaggatgtttcctttgtgatggaccgcagtgttgcattaatgacgatacaattgaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2588271 |
ttcgttccctgttggccaccatggtggaggaatgccgctttccaaaggatgtttcctttgtggtggatcgcagtgttgcattaatgacgatacaattgaa |
2588172 |
T |
|
| Q |
107 |
cctaatattgtatcaggtagatcatacaaggaataaggctttacttgctcatcaagcaacatgccattcattgttgaaactccacgttcttcttgatatc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2588171 |
cctaatattgtatcaggtagatcatacaaggagtaaggctttacttgctcatcaagcaacatgccattcattgttgaaactccacgttcttcttcatatt |
2588072 |
T |
|
| Q |
207 |
tagcgattgcagctagaccgtttttctcaaagtttacttggtctttccaccagccgcgtagattttccgaacaacc |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2588071 |
tagcgattgcagctagaccgtttttctcaaagtttacttggtctttccaccagccgcgtagattttccgaacaacc |
2587996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 57; Significance: 8e-24; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 14 - 258
Target Start/End: Complemental strand, 1482587 - 1482343
Alignment:
| Q |
14 |
cctgttggccaccatggtggaggaatgccgctttccaaaggatgtttcctttgtgatggaccgcagtgttgcattaatgacgatacaattgaacctaata |
113 |
Q |
| |
|
|||| |||||||||||||||||||||| | ||||| ||||||| | | ||||||| |||| |||| ||||||||| |||| |||| || |||||||||| |
|
|
| T |
1482587 |
cctgatggccaccatggtggaggaatgtctctttctaaaggatatcttctttgtggtggatcgcaatgttgcattcatgatgataaaagtgaacctaatg |
1482488 |
T |
|
| Q |
114 |
ttgtatcaggtagatcatacaaggaataaggctttacttgctcatcaagcaacatgccattcattgttgaaactccacgttcttcttgatatctagcgat |
213 |
Q |
| |
|
|||| |||||||| |||| ||| || |||| ||||| | ||| || ||||||| ||||||||||||||| ||| | || |||| || | || || |
|
|
| T |
1482487 |
ttgtgtcaggtagttcattcaatgagtaagctgttactggttcaccattcaacatgtcattcattgttgaaattcctctttaatcttcatgatttgcaat |
1482388 |
T |
|
| Q |
214 |
tgcagctagaccgtttttctcaaagtttacttggtctttccacca |
258 |
Q |
| |
|
||||||| ||||||||| ||||| ||||| |||||||||||| |
|
|
| T |
1482387 |
tgcagctgcaccgtttttttcaaattttaccctgtctttccacca |
1482343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 11 - 51
Target Start/End: Complemental strand, 41334775 - 41334735
Alignment:
| Q |
11 |
ttccctgttggccaccatggtggaggaatgccgctttccaa |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41334775 |
ttccctgttggccaccatggtggaggaatgcctttttccaa |
41334735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 11 - 51
Target Start/End: Complemental strand, 20901691 - 20901651
Alignment:
| Q |
11 |
ttccctgttggccaccatggtggaggaatgccgctttccaa |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20901691 |
ttccctgttggccaccatggtggaggaatgcctttttccaa |
20901651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 11 - 51
Target Start/End: Complemental strand, 20920154 - 20920114
Alignment:
| Q |
11 |
ttccctgttggccaccatggtggaggaatgccgctttccaa |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20920154 |
ttccctgttggccaccatggtggaggaatgcctttttccaa |
20920114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University