View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3445_low_11 (Length: 285)
Name: NF3445_low_11
Description: NF3445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3445_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 11 - 270
Target Start/End: Complemental strand, 33421691 - 33421432
Alignment:
| Q |
11 |
cagaacctgtgcaagggttttgacgtaacaatcaatcatctgctgtttggtagcaccttcaccaccaggcttatcaataataataagccagtgattgtaa |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33421691 |
cagaacttgtgcaagggttttgacgtaacaatcaatcatctgctgtttggtagcaccttcaccaccaggcttatcaataataataagccagtgattgtaa |
33421592 |
T |
 |
| Q |
111 |
tcacaaccagggaaaagcggagccatctcagcaggaggacggtcactgaaggaggtgttggaccccggtactagcggcgagtagttgcagtaaccggccc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33421591 |
tcacaaccagggaaaagcggagccatctcagcaggaggacggtcactgaaggaggtgttggaccccggtactagcggcgagtagttgcagtaaccggccc |
33421492 |
T |
 |
| Q |
211 |
ggtgaatcccgccgaaatggagtgattggaagatggtttgggacattgggatgatgaatc |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33421491 |
ggtgaatcccgccgaaatggagtgattggaagatggtttgggacattgggatgatgaatc |
33421432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 39 - 161
Target Start/End: Original strand, 15695301 - 15695423
Alignment:
| Q |
39 |
caatcaatcatctgctgtttggtagcaccttcaccaccaggcttatcaataataataagccagtgattgtaatcacaaccagggaaaagcggagccatct |
138 |
Q |
| |
|
||||||||||| |||||||| | |||||||||||||||||| ||||| |||| ||||||||| || | |||||||| || || || ||||||||||| | |
|
|
| T |
15695301 |
caatcaatcatttgctgtttcgaagcaccttcaccaccaggtttatccataacaataagccaatgttcataatcacaccctggaaacagcggagccatat |
15695400 |
T |
 |
| Q |
139 |
cagcaggaggacggtcactgaag |
161 |
Q |
| |
|
| | ||| ||||| || |||||| |
|
|
| T |
15695401 |
ccgtaggcggacgctcgctgaag |
15695423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 80
Target Start/End: Original strand, 10508289 - 10508345
Alignment:
| Q |
24 |
agggttttgacgtaacaatcaatcatctgctgtttggtagcaccttcaccaccaggc |
80 |
Q |
| |
|
||||||| || |||| |||||||||||||||| | | ||||||||||||||||||| |
|
|
| T |
10508289 |
agggtttggatgtaataatcaatcatctgctgctcagaagcaccttcaccaccaggc |
10508345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University