View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3445_low_17 (Length: 258)
Name: NF3445_low_17
Description: NF3445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3445_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 120 - 239
Target Start/End: Complemental strand, 18790269 - 18790153
Alignment:
| Q |
120 |
gtctccaaacaaaatgtaaaatgaatattatagacttcaaaccattagaatgcatttatatgtcaatgaaatagatccaaatatggtttatgatgatata |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
18790269 |
gtctccaaacaaaatgtaaaatgaatattatagacttcaaaccattagaatggattcataggtcaatgaaatagatccaaatatgattt---atgatata |
18790173 |
T |
 |
| Q |
220 |
ccatcatggcgtactttcat |
239 |
Q |
| |
|
|||||||| ||||||||||| |
|
|
| T |
18790172 |
ccatcatgtcgtactttcat |
18790153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 158 - 213
Target Start/End: Original strand, 12890732 - 12890787
Alignment:
| Q |
158 |
aaaccattagaatgcatttatatgtcaatgaaatagatccaaatatggtttatgat |
213 |
Q |
| |
|
|||||||||||| | ||||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
12890732 |
aaaccattagaaaggatttagacgtcaatgagttagatccaaatatggtttatgat |
12890787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 158 - 213
Target Start/End: Original strand, 52921237 - 52921292
Alignment:
| Q |
158 |
aaaccattagaatgcatttatatgtcaatgaaatagatccaaatatggtttatgat |
213 |
Q |
| |
|
|||||||||||| | ||||| | ||||||||| | ||||||||||||||||||||| |
|
|
| T |
52921237 |
aaaccattagaaaggatttagaggtcaatgaattggatccaaatatggtttatgat |
52921292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University