View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3446_low_11 (Length: 280)
Name: NF3446_low_11
Description: NF3446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3446_low_11 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0003 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 267
Target Start/End: Complemental strand, 107773 - 107524
Alignment:
| Q |
19 |
ctttttatcctccaattcatatgcttcatcatttttgttatgactcacggtaatagctcggtgacgccgccgccggtgttag-tctagcgttgaacactg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |||||||||||||||| ||||||||||||||||| |
|
|
| T |
107773 |
ctttttatcctccaattcatatgcttcatcatttttgttatgacttacggtaatagctcggtgccaccgccgccggtgttagatctagcgttgaacactg |
107674 |
T |
|
| Q |
118 |
caagtccatactatgttcatcctaacgaaaatccagcaatttctctcgttacgaaactcttcactcccagcaattaccattcatggtcatgattgatgca |
217 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
107673 |
caagtccgtactatgttcatcctaacaaaaatccagcaatttctcttgttacgaaactcttcactcccagcaattaccattcatggtcatgattgatgca |
107574 |
T |
|
| Q |
218 |
catggctttgatcggaaagaacaaattcaagttcgtcgacggtttgatct |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
107573 |
catggctttgatcggaaagaacaaattcaagttcgtcgacggttcgatct |
107524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 104 - 261
Target Start/End: Original strand, 21949066 - 21949224
Alignment:
| Q |
104 |
agcgttgaacactgcaagtccatactatgttcatcctaacgaaaatccagcaatttctctcgttacgaaactcttca-ctcccagcaattaccattcatg |
202 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||| || ||||||||||||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
21949066 |
agcgttgaacactgctagtccgtactatgttcatcctaacgaaaatccagaaagttctctcgttacgaaactctttaactcccagcaattaccatccatg |
21949165 |
T |
|
| Q |
203 |
gtcatgattgatgcacatggctttgatcggaaagaacaaattcaagttcgtcgacggtt |
261 |
Q |
| |
|
|||| || |||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21949166 |
gtcaagagtgatgcgcaaggctttgatcggaaagaacaaattcaagttcgtcgacggtt |
21949224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University