View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3446_low_12 (Length: 264)
Name: NF3446_low_12
Description: NF3446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3446_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 13 - 244
Target Start/End: Complemental strand, 52036167 - 52035939
Alignment:
| Q |
13 |
gaacctgtgtatagtgaatttgtgcaacaccaatagagattcttattaaatggaataaatgcaattgctcgttgttgtgaacttaattagcattcgcaat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52036167 |
gaacctgtgtatagtgaatttgtgcaacaccaatagagattcttattaaatggaataaatgcaattggtcgttgttgtgaacttaattagcattcgcaat |
52036068 |
T |
 |
| Q |
113 |
tattgtttacttgctgtatagaatctcaaacagactaacaacagtagttgccttgcctaatgttgaggcatcccctgttcccacagaaaacggttaaata |
212 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
52036067 |
tattgtttacttgttgtatagaatctcaaacagactaacaacagtagttgccttgccttatgttgaggcatcccctgttcccacagaaaacggtta---a |
52035971 |
T |
 |
| Q |
213 |
atggttaatgtaatctattgagtggtttatca |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
52035970 |
atggttaatgtaatctattgagtggtttatca |
52035939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University