View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3446_low_20 (Length: 201)
Name: NF3446_low_20
Description: NF3446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3446_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 65; Significance: 9e-29; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 17 - 139
Target Start/End: Complemental strand, 7440444 - 7440313
Alignment:
| Q |
17 |
agtttataacgagacactcttctaaactctagcacgttttaataccaaaaacggacaatacc---------nnnnnnnnncggtgcagcacgcggataaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| || |
|
|
| T |
7440444 |
agtttataacgagacactcttctaaactctagcacgttttaataccaaaaacggacaataccaaaaaacaaaaaaaaaaacggtgcagcacgtggattaa |
7440345 |
T |
 |
| Q |
108 |
gttccgaacaaaacacaactataagattatta |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7440344 |
gttccgaacaaaacacaactataagattatta |
7440313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 188
Target Start/End: Complemental strand, 7440314 - 7440281
Alignment:
| Q |
155 |
taagaatgatgagaaaaaagattcattagcctat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
7440314 |
taagaatgatgagaaaaaagattcattagcctat |
7440281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University