View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3447-Insertion-10 (Length: 530)
Name: NF3447-Insertion-10
Description: NF3447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3447-Insertion-10 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 471; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 471; E-Value: 0
Query Start/End: Original strand, 8 - 530
Target Start/End: Original strand, 7405293 - 7405815
Alignment:
| Q |
8 |
agatgagggagttggcttacggtttggagctgagtcaacaacgatttatttgggtggtgcggcggcccacggaggacaatgcatctgcaacgtttttcaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
7405293 |
agatgagggagttggcttacggtttggagctgagtcaacaacggtttatttgggtggtgcggcggcccacagaggacaatgcatccgcaacgtttttcaa |
7405392 |
T |
|
| Q |
108 |
cattgcgggtgcagatggaacaattgtggcagattacttgccggaggggtttttgaataggacaaaagacgtagggctttgtgttcccatgtgggcccct |
207 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7405393 |
cattgcgggtgcagatggaacaattatggtagattacttgccgaaggggtttttgaataggacaaaagacgtagggctttgtgttcccatgtgggcccct |
7405492 |
T |
|
| Q |
208 |
caagctgaaatattgaaacatccttcaacgggtggttttttgacacattgcggttggaattctgtgttggagagtattcataacggtgttccaatggttg |
307 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7405493 |
caagctgagatattgaaacatccttcaacgggtggttttttgacacattgtggttggaattctgtgttggagagtattcataacggtgttccaatggttg |
7405592 |
T |
|
| Q |
308 |
catggccgctttatgcagagcagaagatgaatgcaactatgttatcagaggagcttggtgtggcggtgaaagcgacaacagcggtggcagagggtggtgt |
407 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
7405593 |
catggccgctttatgctgagcagaagatgaatgcaactatgttatcagaggagcttggtgtggcggtgaaagcgacaaaaacggtggcagagggtggtgt |
7405692 |
T |
|
| Q |
408 |
tgtttgtagggaaaagatagcggaggtgattagaaaagtgatggtggatgaagaaggtgtagctatgagagttaaagttaaggagtataaggtaagtgga |
507 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7405693 |
tgtttgtagggaaaagatagcggaggtgattagaaaagtgatggtggatgatgaaggtgtagctatgagagttaaagttaaggagtataaggtaagtgga |
7405792 |
T |
|
| Q |
508 |
gaaaaagctttgtccgtatttgg |
530 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
7405793 |
gaaaaagctttgtccgtgtttgg |
7405815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University