View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3447-Insertion-28 (Length: 190)
Name: NF3447-Insertion-28
Description: NF3447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3447-Insertion-28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 4e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 4e-89
Query Start/End: Original strand, 8 - 177
Target Start/End: Complemental strand, 2487696 - 2487527
Alignment:
| Q |
8 |
cgaccgagcttcactatgatccttttcaaaagtgctgctgctccagaagcctgatgatccatcatctttagtcacggtttggccttgaattatttctccc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2487696 |
cgaccgagcttcactatgatccttttcaaaagtgctgctgctccagaagcctgatgatccatcatctttagtcacggtttggccttgaattatttctccc |
2487597 |
T |
 |
| Q |
108 |
ttacatccctcatccattgaaacagtagctcgaggtttttcgcggcttctaagacaacctatgctctatc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2487596 |
ttacatccctcatccattgaaacagtagcttgaggtttttcgcggcttctaagacaacctatgctctatc |
2487527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University