View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3447-Insertion-5 (Length: 1011)
Name: NF3447-Insertion-5
Description: NF3447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3447-Insertion-5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-125
Query Start/End: Original strand, 8 - 272
Target Start/End: Original strand, 15935869 - 15936133
Alignment:
| Q |
8 |
gtaagggaccttgtttgccaatctgatggccacttgccgaatgagtgggtcgaacttttcgtccacgacgttgccggagccggaagccatcctgtatctg |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15935869 |
gtaagagaccttgtttgccaatctgatggccacttgccgaatgagcgggtcgaacttttcgtccacgacgttgccggagccggaagccatcctgtatctg |
15935968 |
T |
 |
| Q |
108 |
tttgtgtttgtttagcaggcaggttaggttaggttacgtgatatttgagtatgagtatttaaccctactgttttggatataacaaacnnnnnnnccctaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
15935969 |
tttgtgtttgtttagcaggcaggttaggttaagttacgtgatattttagtatgagtatttaaccctactgttttggatataacaaacaaaaaaaccctaa |
15936068 |
T |
 |
| Q |
208 |
ttacgtgaagccgaacctaacacctcacccttaaaagcagccaatcaaatattttcaataattaa |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15936069 |
ttacgtgaagccgaacctaacacctcacccttaaaagcagccaatcaaatattttcaataattaa |
15936133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University