View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3447R-Insertion-3 (Length: 296)
Name: NF3447R-Insertion-3
Description: NF3447R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3447R-Insertion-3 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 8 - 296
Target Start/End: Complemental strand, 38090520 - 38090231
Alignment:
| Q |
8 |
atcatcgatggtcattggtccaattatacatttttgcactccaatattggcaatcattgccctaattatgcataatcgagaaatttattttcagttcgaa |
107 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38090520 |
atcatcgatggtcattgctccaattatacatttttgcactccaatattgggaatcattgccctaattatgcataatcgacaaatttattttcagttcgaa |
38090421 |
T |
 |
| Q |
108 |
aatttctctcttgcttctctgtgctcccttgatatctattttccccaacagctcaac-aaatccaattttgccattaatgtattattccttgggctatta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38090420 |
aatttctctcttgcttctctgtgctcccttaatatctattttcctcaacagctcaacaaaatccaattttgccattaatgtattattccttgggctatta |
38090321 |
T |
 |
| Q |
207 |
ttatggataattggatcataacattactcttgattgaagcaaacctaaatatccgcggttttggtaatacatacactaaatccgcagttc |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38090320 |
ttatggataattggatcataacattactcttgattgaagcaaacctaaatatccgcggttttggtaatacagacactaaatccgcagttc |
38090231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University