View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3447_high_20 (Length: 321)
Name: NF3447_high_20
Description: NF3447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3447_high_20 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 33 - 321
Target Start/End: Complemental strand, 49126426 - 49126135
Alignment:
| Q |
33 |
tatgtctgttgtccctcaaaatatgataattttcannnnnnnnc---tcacatttgggtttctcatttatgaaaatgtttcagttttggaccttatcgct |
129 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
49126426 |
tatgtccgttgtccctcaaaatatgataattttcatttttttttctttcacatttgggtttctcatttatgaaaatgtttcagttttggaccttatagct |
49126327 |
T |
 |
| Q |
130 |
aactccgtctgtcaaaaagcctatgtaacagctactgaattttgatataagaaatccttgcttggaacatctaaacgcatgtaacagacaactaagattt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49126326 |
aactccgtctgtcaaaaagcctatgtaacagctactgaattttgatataagaaatccttgcttggaacatctaaacgcatgtaacagacaactaagattt |
49126227 |
T |
 |
| Q |
230 |
tgtagcttttacacagactctctggctgatggagttggctacatggatcggagttgacaccttttcaaaagtgagatgaaaaactgagcagc |
321 |
Q |
| |
|
|||||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49126226 |
tgtagcttttacacagactctctgactgacgaagttggctacatggatcggagttgacaccttttcaaaagcgagatgaaaaactgagcagc |
49126135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University