View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3447_low_24 (Length: 303)
Name: NF3447_low_24
Description: NF3447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3447_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 171 - 294
Target Start/End: Original strand, 5370750 - 5370873
Alignment:
| Q |
171 |
gaggtctaagacgattgctttgatgttgctctactcaaaacaaattcttcagattccatttgcatgcaggaatcagtgttctttactacaagtatcagct |
270 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5370750 |
gaggtctaagacgattgctttggtgctgctctactcaaaacaaattcttcagattccatttgcatgcaggaatcagtgttctttactacaagtatcagct |
5370849 |
T |
 |
| Q |
271 |
agttctttttcctttccttcttat |
294 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5370850 |
agttctttttcctttccttcttat |
5370873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 63 - 133
Target Start/End: Original strand, 5370642 - 5370713
Alignment:
| Q |
63 |
gttcataatagtatt-gaggaaatttgttagaatatgagacctttattaagtaaagttttgataatataagg |
133 |
Q |
| |
|
||||||||||| ||| ||| ||| ||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
5370642 |
gttcataatagcatttgagaaaaattgttagaatatgagacctttatcaagtaaagtttgtataatataagg |
5370713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University