View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3447_low_30 (Length: 249)
Name: NF3447_low_30
Description: NF3447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3447_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 109 - 236
Target Start/End: Original strand, 37953799 - 37953924
Alignment:
| Q |
109 |
ggtgccatttagaatggacctttacatgtattggtccatgatggacaaatttatgaaaaccatttgattaagtacactttatgatcttatcatatactct |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
37953799 |
ggtgccatttagaatggacctttacatgtattggtccatgatggacaaatttatgaaaaccatttgattaagtacactttatgatcttatcatgta--ct |
37953896 |
T |
|
| Q |
209 |
ctctaccatataatatttcctttctttt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
37953897 |
ctctaccatataatatttcctttctttt |
37953924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 7114522 - 7114418
Alignment:
| Q |
1 |
cgtactcgttctcattctctatgtttgagtttctatagcaacgtgaaaagaaagacaattgnnnnnnnnnttggaattgaggaggatcatttttaaattc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
7114522 |
cgtactcgttctcattctctatgtttgagtttctatagcaacgtgaaaagaaagacacttgaaaaaaaaaatggaattaaggaggatcatttttaaattc |
7114423 |
T |
|
| Q |
101 |
agaaa |
105 |
Q |
| |
|
||||| |
|
|
| T |
7114422 |
agaaa |
7114418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 109 - 196
Target Start/End: Original strand, 16407505 - 16407592
Alignment:
| Q |
109 |
ggtgccatttagaatggacctttacatgtattggtccatgatggacaaatttatgaaaaccatttgattaagtacactttatgatctt |
196 |
Q |
| |
|
|||| ||||||||||||||| || ||| |||||||||||||||||||||||||| | ||||||| || |||| ||||||||| ||||| |
|
|
| T |
16407505 |
ggtgacatttagaatggaccattccatatattggtccatgatggacaaatttataagaaccattggaataagaacactttataatctt |
16407592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 182 - 236
Target Start/End: Original strand, 16407608 - 16407662
Alignment:
| Q |
182 |
acactttatgatcttatcatatactctctctaccatataatatttcctttctttt |
236 |
Q |
| |
|
||||||||||||||||| || ||||| ||||| ||||||||||| |||||||||| |
|
|
| T |
16407608 |
acactttatgatcttatgatgtactccctctagcatataatattccctttctttt |
16407662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University