View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3447_low_31 (Length: 242)
Name: NF3447_low_31
Description: NF3447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3447_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 3487082 - 3487301
Alignment:
| Q |
18 |
gcttgtaatcgctggtgtatcgtgggatctcaatcgattccttcaattcatattcaccgctcttgtaatcgctattggattgcacactcttgtcaagaac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| |
|
|
| T |
3487082 |
gcttgtaatcgctggtgtatcgtgggatctcaatcgattccttcaattcatattcaccgctcttgtaatcgctattggattacacactcttgtcaaaaac |
3487181 |
T |
|
| Q |
118 |
accgcttctaaatacttcgaagtcgacgctaatttcgaaggagatcatcatccttcttctcccacctccccaatgcccggtgttcttaactctgatgagc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3487182 |
accgcttctaaatacttcgaagtcgacgctaatttcgaaggagatcatcatccttcttctcccacctccccaatgcccggtgttcttaactccgatgagc |
3487281 |
T |
|
| Q |
218 |
ctgtttgtgctgtctgtgct |
237 |
Q |
| |
|
||||||||||||| |||||| |
|
|
| T |
3487282 |
ctgtttgtgctgtttgtgct |
3487301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University