View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3447_low_32 (Length: 240)
Name: NF3447_low_32
Description: NF3447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3447_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 38710347 - 38710566
Alignment:
| Q |
1 |
catgctttgaaaatcacatatgatggaagataaaggggtgtggcagaggaagacaattatccaacaacgagataaagcaatttcaaagaagaaggcatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38710347 |
catgctttgaaaatcacatatgatggaagataaaggggtgtggcagaggaagacaattatccaacaacgagataaagcaatttcaaagaagaaggcatag |
38710446 |
T |
 |
| Q |
101 |
ttcttggacttaggttgtagtaaccatatgtgtggtaataaaaaatggttctttgaaggagagagagtaatcttatatgaaatattggaggcattataca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38710447 |
ttcttggacttaggttgtagtaaccatatgtgtggtaataaaaaatggttctttgaaggagagagagtaatcttataagaaatattggaggcattataca |
38710546 |
T |
 |
| Q |
201 |
actcattcctagtgtgtagt |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
38710547 |
actcattcctagtgtgtagt |
38710566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University