View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3447_low_35 (Length: 238)
Name: NF3447_low_35
Description: NF3447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3447_low_35 |
 |  |
|
| [»] scaffold0565 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 36362378 - 36362157
Alignment:
| Q |
1 |
tgcccaagtgcaaaattaccaaagcactgtgtcacaagtggtgaatatactaggaactgaggatcaagctgcaagtcacttgagcaagtgtatttactca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36362378 |
tgcccaagtgcaaaattaccaaagcactgtgtcacaagtggtgaatatactaggaactgaggatcaagctgcaagtcacttgagcaagtgtatttactca |
36362279 |
T |
 |
| Q |
101 |
attggattgggtagcaatgattacttgaacaactatttcatgcctcaattctataacacacatgatcagtatacaccagatgagtatgctgatgatctta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36362278 |
attggattgggtagcaatgattacttgaacaactatttcatgcctcaattctataacacacacgatcagtatacaccagatgagtatgctgatgatctta |
36362179 |
T |
 |
| Q |
201 |
ttcaagcatatactgaacaact |
222 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
36362178 |
ttcaatcatatactgaacaact |
36362157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0565 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0565
Description:
Target: scaffold0565; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 83 - 145
Target Start/End: Complemental strand, 4450 - 4388
Alignment:
| Q |
83 |
agcaagtgtatttactcaattggattgggtagcaatgattacttgaacaactatttcatgcct |
145 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||| | ||||| |||||||||||| |
|
|
| T |
4450 |
agcaagtgcatttatacaattggattgggtagcaatgattaccttaacaattatttcatgcct |
4388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 101 - 145
Target Start/End: Original strand, 8491904 - 8491948
Alignment:
| Q |
101 |
attggattgggtagcaatgattacttgaacaactatttcatgcct |
145 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
8491904 |
attggattgggtagcaatgattaccttaacaactatttcatgcct |
8491948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 101 - 145
Target Start/End: Original strand, 7614776 - 7614820
Alignment:
| Q |
101 |
attggattgggtagcaatgattacttgaacaactatttcatgcct |
145 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
7614776 |
attggattgggtagcaatgattaccttaacaactatttcatgcct |
7614820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University