View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3447_low_41 (Length: 218)

Name: NF3447_low_41
Description: NF3447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3447_low_41
NF3447_low_41
[»] chr6 (2 HSPs)
chr6 (88-176)||(5126272-5126360)
chr6 (52-89)||(5126179-5126216)


Alignment Details
Target: chr6 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 88 - 176
Target Start/End: Original strand, 5126272 - 5126360
Alignment:
88 ctagtagcaccgatacttacccaaccattcttttacttccttccatctactcttgagaattttcttctgtttgttatgttttaaatcat 176  Q
    |||| |||||| ||||||| |||||||||||||||||  ||||||||| ||||||||||||||||||| ||||||||| ||||||||||    
5126272 ctagcagcaccaatacttatccaaccattcttttactgtcttccatctcctcttgagaattttcttctttttgttatgctttaaatcat 5126360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 52 - 89
Target Start/End: Original strand, 5126179 - 5126216
Alignment:
52 aatgcttcagaaaccagagcaatagtagctaccaatct 89  Q
    |||| |||||||||||||||||||||||||||||||||    
5126179 aatgtttcagaaaccagagcaatagtagctaccaatct 5126216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University