View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3447_low_41 (Length: 218)
Name: NF3447_low_41
Description: NF3447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3447_low_41 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 88 - 176
Target Start/End: Original strand, 5126272 - 5126360
Alignment:
| Q |
88 |
ctagtagcaccgatacttacccaaccattcttttacttccttccatctactcttgagaattttcttctgtttgttatgttttaaatcat |
176 |
Q |
| |
|
|||| |||||| ||||||| ||||||||||||||||| ||||||||| ||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
5126272 |
ctagcagcaccaatacttatccaaccattcttttactgtcttccatctcctcttgagaattttcttctttttgttatgctttaaatcat |
5126360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 52 - 89
Target Start/End: Original strand, 5126179 - 5126216
Alignment:
| Q |
52 |
aatgcttcagaaaccagagcaatagtagctaccaatct |
89 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5126179 |
aatgtttcagaaaccagagcaatagtagctaccaatct |
5126216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University