View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3447_low_44 (Length: 215)
Name: NF3447_low_44
Description: NF3447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3447_low_44 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 171
Target Start/End: Original strand, 39823405 - 39823576
Alignment:
| Q |
1 |
caccaatatcagctttcctattctactctttcgtacatgtttt-cccctggaaccttgtggtattatcactctgtacatttagttgcttcgggacaagtt |
99 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39823405 |
caccgatatcagctttcctattctactctttcgtacatgtttttcccctggaaccttgtggtattatcactctgtacatttagttgcttcgggacaagtt |
39823504 |
T |
|
| Q |
100 |
tcatcttcttgattagtctaaaaaacgacgtccgtttcaaaaacattcagaccaacagccgtaacttcgctt |
171 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39823505 |
tcatcttcttgtttagtctaaaaaacgacgtccgtttcaaaaacattcagaccaacagccgtaacttcgctt |
39823576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 39917379 - 39917582
Alignment:
| Q |
1 |
caccaatatcagctttcctattctactctttcgtacatgttttcccctggaaccttgtggtattatcactctgtacatttagttgcttcgggacaagttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||| || |||||||| |||||| |||| |
|
|
| T |
39917379 |
caccaatatcagctttcctattctactctttcgtacatgttttcccgtggaaacttgtggtattatcactttgtaccttcagttgctttgggacacgttt |
39917478 |
T |
|
| Q |
101 |
catcttcttgattagtctaaaaaacgacgtccgtttcaaaaacattcagaccaacagccgtaactt-cgcttccggcagctatttgggggttttacattt |
199 |
Q |
| |
|
||||||||| |||| | ||||| ||||||||||||||||| | ||||||||||| ||||||| ||||||| || ||||||||||||| || ||||| |
|
|
| T |
39917479 |
catcttcttctttagccataaaaattacgtccgtttcaaaaacttccagaccaacagttgtaacttccgcttccagccgctatttgggggtcttgcattt |
39917578 |
T |
|
| Q |
200 |
ctct |
203 |
Q |
| |
|
|||| |
|
|
| T |
39917579 |
ctct |
39917582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University