View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3447_low_45 (Length: 212)
Name: NF3447_low_45
Description: NF3447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3447_low_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 19 - 202
Target Start/End: Complemental strand, 50554804 - 50554622
Alignment:
| Q |
19 |
attgtatatcttcttgcttgtttattggaaccctttatgccatctttcactcttgaggtaaaattatttctctctatacttgtgttcctcttttgttggt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50554804 |
attgtatatcttcttgcttgtttattggaaccctttatgccatctttcactcttgaggtaaaattatttctctctatacttgtgttcctcttttgttggt |
50554705 |
T |
|
| Q |
119 |
attttgtttacttatcccatgacatttttgacacttctctattttcttgccctgaagctatttaagcagctaaatttgtctgtg |
202 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
50554704 |
attttgtttagttatcccatgacatttttgacactt-tctattttcttgccctgaaggtatttaagcagctaaatttgtctgtg |
50554622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 133
Target Start/End: Complemental strand, 29766121 - 29766007
Alignment:
| Q |
19 |
attgtatatcttcttgcttgtttattggaaccctttatgccatctttcactcttgaggtaaaattatttctctctatacttgtgttcctcttttgttggt |
118 |
Q |
| |
|
||||| ||||||||||||||||| |||||||| |||||||||||||||| ||||||||||| || | ||| | ||| |||| ||||| ||||||| || |
|
|
| T |
29766121 |
attgtgtatcttcttgcttgtttgttggaaccttttatgccatctttcagtcttgaggtaatataacttccatacatatttgtattcctgttttgttagt |
29766022 |
T |
|
| Q |
119 |
attttgtttacttat |
133 |
Q |
| |
|
|||||| |||||||| |
|
|
| T |
29766021 |
attttgattacttat |
29766007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University