View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3447_low_9 (Length: 489)
Name: NF3447_low_9
Description: NF3447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3447_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 418; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 418; E-Value: 0
Query Start/End: Original strand, 11 - 473
Target Start/End: Original strand, 23687227 - 23687689
Alignment:
| Q |
11 |
cacagaaacacaacctctaacgctattggaatttgtctccttccacaagaactcatccaaaacatctttctctctcttgttttacccgaaattgtacgtc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
23687227 |
cacagaaacacaacctctaacgctattggactttgtctcctcccacaagaactcatccaaaacatctttctctctcttgttttacccgaaattgttcgcc |
23687326 |
T |
|
| Q |
111 |
tcaaactcctcaacaaatctttctctaccataatctccgatcacaccttcgttcgtcagtgcaactctctttcaaactccaccacatggctcttcgtcta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23687327 |
tcaaactcctcaacaaatctttctctaccataatctccgatcacaccttcgttcgtcagtgcaactctctttcaaactccaccacatggctcttcgtcta |
23687426 |
T |
|
| Q |
211 |
caagaaacgctggctacgcgacgcggtacttcatgctttcaccgatcggagctccgatcgctggttccggattcccatgacggagcttcttaaaccggtt |
310 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23687427 |
caagaaacgctggctacgcgacgcggtgcttcatgctttcaccgatcggagctccgatcgctggttccggattcccatgacggagcttcttaaaccggtt |
23687526 |
T |
|
| Q |
311 |
gactttcacggcgaggatctttacttccttgctgcttcagcaaatgtttttctcttcgcttccaacaacgttcgtgaagtcatcgccgttaatttagtct |
410 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23687527 |
gactttcacggcgaggatctttacttccttgctgcttcagcaaacgtttttctcttcgcttccaacaacgttcgtgaagtcatcgccgttaatttagtct |
23687626 |
T |
|
| Q |
411 |
ccgtcactgttnnnnnnntccctccttctccgttaggtccacgtggcacttcctcgtggagaa |
473 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23687627 |
ccgtcactgttaaaaaaatccctccttctccgttaggtccacgtggcacttcctcgtggagaa |
23687689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University