View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3448_high_10 (Length: 282)
Name: NF3448_high_10
Description: NF3448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3448_high_10 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 35 - 282
Target Start/End: Original strand, 8437313 - 8437544
Alignment:
| Q |
35 |
aagtaatattaaacaaatatggtttttcatggtcagctcttggattattcactagcttattttaatttcctcttaattatttgcattgatacaattctag |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8437313 |
aagtaatattaaacaaatatggtttttcatggtcagctcttggattagtcactagcttcttttaatttcctctta----tttgcattgatacaattctag |
8437408 |
T |
|
| Q |
135 |
ttaagtttgatcttgtcaaaatgaaaatataaacatgtacacactataataagcnnnnnnntaactttttacattagttataacttagtgaagtgtgtgg |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
8437409 |
ttaagtttgatcttgtcaaaatgaaaatataaacatgtacacactataataagc-aaaaaataactttttaca-----------ttagtgaagtgtgtgg |
8437496 |
T |
|
| Q |
235 |
agggcagagggcgtatgctgaaacgtgtaacagtttagttttgttctc |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8437497 |
agggcagagggcgtatgctgaaacgtgtaacagtttagttttgttctc |
8437544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University