View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3448_high_5 (Length: 350)
Name: NF3448_high_5
Description: NF3448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3448_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 339
Target Start/End: Original strand, 11744025 - 11744349
Alignment:
| Q |
1 |
ttgtacgctcgtcggtgagtctctaatttgattctatattgcgtttttagtataagttaattttggtnnnnnnnnnnncnnnnnnnnngctttgatttgg |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
11744025 |
ttgtacgctcgtcagtgagtctctaatttgattctatattgcctttttagtataagttacttttggtaaaaaaaaact---tttttttgctttgatttgg |
11744121 |
T |
 |
| Q |
101 |
atcgagagaatcaccctgatagaggtggttgagcagcacttcacatctgttgatgggagatactacatgcagacactctgactcccagataagtaagaaa |
200 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11744122 |
atcgagagaatcaccctgagagaggcggttgagctgcacttcacatctgttgatgagagatactacatgcagacactctgactcccagataagtaagaaa |
11744221 |
T |
 |
| Q |
201 |
aatggaagtatgagatatgttgaatagagattgtgtctcttttcctccgtttcaagagatttagagtgggattgagaaggagcctccgatgagcctccga |
300 |
Q |
| |
|
|||||||||||||| ||||||||||||| || |||||||||| || ||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
11744222 |
aatggaagtatgaggtatgttgaatagaaatagtgtctctttcccgacgtttcaagagatttagagtgggattgag-----------gaggagcctccga |
11744310 |
T |
 |
| Q |
301 |
gtagtaacgtagccatgatattcgcccttgtccctgcct |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11744311 |
gtagtaacgtagccatgatattcgcccttgtccctgcct |
11744349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University