View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3449_high_11 (Length: 260)
Name: NF3449_high_11
Description: NF3449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3449_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 7 - 208
Target Start/End: Complemental strand, 36827704 - 36827500
Alignment:
| Q |
7 |
gagagaagaaggtttggaaacgatgacgttttgaggaaggggattatcagaaagaagggtgcatttgggaattttgggggtggtaaaagagagtcgttgg |
106 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36827704 |
gagaggagaaggtttggaaacgatgaagttttgaggaaggggattatcagaacgaagggtgcatttgggaattttgggggtggtaaaagagagtcgttgg |
36827605 |
T |
 |
| Q |
107 |
ggagcgaatgtggatttaggaaattgagcaggggaaaatttgacggaggagcgaagagtg---gcggtggaggaggatgccgccattgacattgcaaggg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36827604 |
ggagcgaatgtggatttaggaaattgagcaggggaaaatttgacggaggagcgaagagtgtgatcggtggaggaggaagccgccattgacattgcaaggg |
36827505 |
T |
 |
| Q |
204 |
aatga |
208 |
Q |
| |
|
||||| |
|
|
| T |
36827504 |
aatga |
36827500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University