View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3449_high_16 (Length: 239)

Name: NF3449_high_16
Description: NF3449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3449_high_16
NF3449_high_16
[»] chr2 (1 HSPs)
chr2 (1-222)||(40944638-40944859)
[»] chr4 (1 HSPs)
chr4 (162-222)||(22775890-22775950)


Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 40944859 - 40944638
Alignment:
1 tatgaacatgtatgcatggcatacttttgtatatggatcatagtttaccgacgacggatcttcgagctcatgagcccccgtggtatgattcagaggtaat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||    
40944859 tatgaacatgtatgcatggcatacttttgtatatggatcatagtttaccgacaacggatcctcgagctcatgagcccccgtggtatgattcagaggtaat 40944760  T
101 cttggaaattggaccattttattaaaaatggcaaaattttaattatctcgagttttctttttgcagtatgatgtgtatggagatctattaggccttctag 200  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40944759 cttggaaattggaccatattattaaaaatggcaaaattttaattatctcgagttttctttttgcagtatgatgtgtatggagatctattaggccttctag 40944660  T
201 gtgcacaccctgtggctccact 222  Q
    ||||||||||||||||||||||    
40944659 gtgcacaccctgtggctccact 40944638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 162 - 222
Target Start/End: Complemental strand, 22775950 - 22775890
Alignment:
162 tgcagtatgatgtgtatggagatctattaggccttctaggtgcacaccctgtggctccact 222  Q
    ||||||||||||||||||| || ||||||||||||||||| ||||| ||||| || |||||    
22775950 tgcagtatgatgtgtatggggacctattaggccttctaggagcacatcctgttgccccact 22775890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University