View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3449_high_18 (Length: 235)
Name: NF3449_high_18
Description: NF3449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3449_high_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 20 - 219
Target Start/End: Complemental strand, 14178290 - 14178090
Alignment:
| Q |
20 |
atgggggtttagcgtttgattgagactcttagggtttggggtttcaaaataagaatcggaggagacaagattgactgctagggtaatcatcagttactat |
119 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||||||||| ||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
14178290 |
atgggggtttagcgtttggttgagactgttagggtttggggtttcagaataagaatcggaggagacgggattgactgttagggtaatcatcagttactat |
14178191 |
T |
|
| Q |
120 |
tgtca-nnnnnnnnactactatttcttttttcaccctcactcctttcactcgccctactaaatttcaaaaatatcttcgtttgaattatataatctgaat |
218 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
14178190 |
tgtcatttttttttactactatttcttttttcaccctcactcctttcatccgccctactaaattccaaaaatatcttcgtttgaattatataatccgaat |
14178091 |
T |
|
| Q |
219 |
t |
219 |
Q |
| |
|
| |
|
|
| T |
14178090 |
t |
14178090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 20 - 103
Target Start/End: Complemental strand, 14182154 - 14182071
Alignment:
| Q |
20 |
atgggggtttagcgtttgattgagactcttagggtttggggtttcaaaataagaatcggaggagacaagattgactgctagggt |
103 |
Q |
| |
|
||||| ||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14182154 |
atgggtgtttaatgtttgattgggactcttagggtttggggtttcaaaataagaatcggaggagacaggattgactgctagggt |
14182071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University