View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3449_low_10 (Length: 296)
Name: NF3449_low_10
Description: NF3449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3449_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 77; Significance: 9e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 134 - 214
Target Start/End: Original strand, 31939516 - 31939596
Alignment:
| Q |
134 |
cttctcaaaaatgtagaatttttatttcaatgattatggattgacacctttattttcataccactcatatactttttcatg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31939516 |
cttctcaaaaatgtagaatttttatttcaatgattatggattgacacctttattttcataccactcttatactttttcatg |
31939596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 12 - 97
Target Start/End: Original strand, 31939394 - 31939479
Alignment:
| Q |
12 |
taatattaccgaagatgaattgaaccaaggttaaaataggtcgaacatattgaattgaactatgtctatgataggttcggtcaata |
97 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
31939394 |
taatattattgaagaagaattgaaccaaggttaaaataggttgaacatattaaattgaactatgtctatgattggttcggtcaata |
31939479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 166 - 206
Target Start/End: Complemental strand, 7580613 - 7580573
Alignment:
| Q |
166 |
attatggattgacacctttattttcataccactcatatact |
206 |
Q |
| |
|
||||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
7580613 |
attatgggttgacaccctttttttcataccactcatatact |
7580573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University