View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3449_low_10 (Length: 296)

Name: NF3449_low_10
Description: NF3449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3449_low_10
NF3449_low_10
[»] chr8 (2 HSPs)
chr8 (134-214)||(31939516-31939596)
chr8 (12-97)||(31939394-31939479)
[»] chr2 (1 HSPs)
chr2 (166-206)||(7580573-7580613)


Alignment Details
Target: chr8 (Bit Score: 77; Significance: 9e-36; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 134 - 214
Target Start/End: Original strand, 31939516 - 31939596
Alignment:
134 cttctcaaaaatgtagaatttttatttcaatgattatggattgacacctttattttcataccactcatatactttttcatg 214  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
31939516 cttctcaaaaatgtagaatttttatttcaatgattatggattgacacctttattttcataccactcttatactttttcatg 31939596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 12 - 97
Target Start/End: Original strand, 31939394 - 31939479
Alignment:
12 taatattaccgaagatgaattgaaccaaggttaaaataggtcgaacatattgaattgaactatgtctatgataggttcggtcaata 97  Q
    ||||||||  ||||| ||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |||||||||||||    
31939394 taatattattgaagaagaattgaaccaaggttaaaataggttgaacatattaaattgaactatgtctatgattggttcggtcaata 31939479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 166 - 206
Target Start/End: Complemental strand, 7580613 - 7580573
Alignment:
166 attatggattgacacctttattttcataccactcatatact 206  Q
    ||||||| |||||||| || |||||||||||||||||||||    
7580613 attatgggttgacaccctttttttcataccactcatatact 7580573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University