View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3449_low_11 (Length: 260)

Name: NF3449_low_11
Description: NF3449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3449_low_11
NF3449_low_11
[»] chr4 (1 HSPs)
chr4 (7-208)||(36827500-36827704)


Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 7 - 208
Target Start/End: Complemental strand, 36827704 - 36827500
Alignment:
7 gagagaagaaggtttggaaacgatgacgttttgaggaaggggattatcagaaagaagggtgcatttgggaattttgggggtggtaaaagagagtcgttgg 106  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
36827704 gagaggagaaggtttggaaacgatgaagttttgaggaaggggattatcagaacgaagggtgcatttgggaattttgggggtggtaaaagagagtcgttgg 36827605  T
107 ggagcgaatgtggatttaggaaattgagcaggggaaaatttgacggaggagcgaagagtg---gcggtggaggaggatgccgccattgacattgcaaggg 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||| ||||||||||||||||||||||    
36827604 ggagcgaatgtggatttaggaaattgagcaggggaaaatttgacggaggagcgaagagtgtgatcggtggaggaggaagccgccattgacattgcaaggg 36827505  T
204 aatga 208  Q
    |||||    
36827504 aatga 36827500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University