View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3449_low_12 (Length: 259)
Name: NF3449_low_12
Description: NF3449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3449_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 65 - 243
Target Start/End: Complemental strand, 34348199 - 34348023
Alignment:
| Q |
65 |
cttccaagtttatgtcttataacacttttacaaattttattaatgcagaattctggtaaattnnnnnnntgtgagggcacaaagcaagatctaaaaagtc |
164 |
Q |
| |
|
|||||||||||| ||||| ||||||||| | ||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34348199 |
cttccaagtttacgtcttgtaacactttaa--aattttattgatgcagaattctggtaaattaaaaaaatgtgagggcacaaagcaagatctaaaaagtc |
34348102 |
T |
|
| Q |
165 |
gaggactatgtttggtaccagtttctagcacatttccagtgactcatgaaacaacagttgatttttggacaccaacatt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34348101 |
gaggactatgtttggtaccagtttctagcacatttccagtgactcatgaaacaacagttgatttttggacaccaacatt |
34348023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 144 - 243
Target Start/End: Complemental strand, 23872692 - 23872593
Alignment:
| Q |
144 |
caaagcaagatctaaaaagtcgaggactatgtttggtaccagtttctagcacatttccagtgactcatgaaacaacagttgatttttggacaccaacatt |
243 |
Q |
| |
|
||||||| ||||| | ||| |||| |||||||| |||||||||||||| ||||||||| ||||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
23872692 |
caaagcaggatcttagaagcagagggctatgtttagtaccagtttctagtacatttccaatgactcatgaacccacagttgaatattggacaccaacatt |
23872593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University