View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3449_low_15 (Length: 245)
Name: NF3449_low_15
Description: NF3449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3449_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 36827838 - 36828066
Alignment:
| Q |
1 |
cagcataattgtgattggactcaacgttcatacagctcccgttgagatgcgtgagaaacttgcaattccagaagcacagtggcctcaagttattcaagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36827838 |
cagcataattgtgattggactcaacgttcatacagctcccgttgagatgcgtgagaaacttgcaattccagaagcacagtggcctcaagttattcaagag |
36827937 |
T |
 |
| Q |
101 |
ttatgtgctcttaatcatattgaagaagcagctgttctcagcacatgtaatcgaattgagatataccttgttgccctctctcaacaccgcggtgttagag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36827938 |
ttatgtgctcttaatcatattgaagaagcagctgttctcagcacatgtaatcgtattgagatataccttgttgccctctctcaacaccgcggtgttagag |
36828037 |
T |
 |
| Q |
201 |
aagtcaccgattggatctccaaggtattc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36828038 |
aagtcaccgattggatctccaaggtattc |
36828066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 113 - 222
Target Start/End: Complemental strand, 28477770 - 28477661
Alignment:
| Q |
113 |
aatcatattgaagaagcagctgttctcagcacatgtaatcgaattgagatataccttgttgccctctctcaacaccgcggtgttagagaagtcaccgatt |
212 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||| || || ||||| |||||||| |||| || || ||||| ||||| ||||| | |||||||||||| | |
|
|
| T |
28477770 |
aatcatattgaagaagcagcagttctgagcacctgcaaccgaatggagatatatgttgtcgcactttctcagcaccgtggtgtcaaagaagtcaccgaat |
28477671 |
T |
 |
| Q |
213 |
ggatctccaa |
222 |
Q |
| |
|
|||| ||||| |
|
|
| T |
28477670 |
ggatgtccaa |
28477661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 47 - 165
Target Start/End: Original strand, 51957160 - 51957278
Alignment:
| Q |
47 |
atgcgtgagaaacttgcaattccagaagcacagtggcctcaagttattcaagagttatgtgctcttaatcatattgaagaagcagctgttctcagcacat |
146 |
Q |
| |
|
|||||||| |||||||| ||||| |||||| | |||||| || |||| |||||| || ||| |||||||||||||||||||||||||| ||||| | |
|
|
| T |
51957160 |
atgcgtgaaaaacttgccattccggaagcagaatggcctagagctattgcagagttgtgcagtctcaatcatattgaagaagcagctgttctgagcacct |
51957259 |
T |
 |
| Q |
147 |
gtaatcgaattgagatata |
165 |
Q |
| |
|
| || ||||| |||||||| |
|
|
| T |
51957260 |
gcaaccgaatggagatata |
51957278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University