View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3449_low_16 (Length: 239)
Name: NF3449_low_16
Description: NF3449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3449_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 40944859 - 40944638
Alignment:
| Q |
1 |
tatgaacatgtatgcatggcatacttttgtatatggatcatagtttaccgacgacggatcttcgagctcatgagcccccgtggtatgattcagaggtaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40944859 |
tatgaacatgtatgcatggcatacttttgtatatggatcatagtttaccgacaacggatcctcgagctcatgagcccccgtggtatgattcagaggtaat |
40944760 |
T |
 |
| Q |
101 |
cttggaaattggaccattttattaaaaatggcaaaattttaattatctcgagttttctttttgcagtatgatgtgtatggagatctattaggccttctag |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40944759 |
cttggaaattggaccatattattaaaaatggcaaaattttaattatctcgagttttctttttgcagtatgatgtgtatggagatctattaggccttctag |
40944660 |
T |
 |
| Q |
201 |
gtgcacaccctgtggctccact |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
40944659 |
gtgcacaccctgtggctccact |
40944638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 162 - 222
Target Start/End: Complemental strand, 22775950 - 22775890
Alignment:
| Q |
162 |
tgcagtatgatgtgtatggagatctattaggccttctaggtgcacaccctgtggctccact |
222 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||| ||||| ||||| || ||||| |
|
|
| T |
22775950 |
tgcagtatgatgtgtatggggacctattaggccttctaggagcacatcctgttgccccact |
22775890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University