View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3449_low_18 (Length: 235)

Name: NF3449_low_18
Description: NF3449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3449_low_18
NF3449_low_18
[»] chr2 (2 HSPs)
chr2 (20-219)||(14178090-14178290)
chr2 (20-103)||(14182071-14182154)


Alignment Details
Target: chr2 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 20 - 219
Target Start/End: Complemental strand, 14178290 - 14178090
Alignment:
20 atgggggtttagcgtttgattgagactcttagggtttggggtttcaaaataagaatcggaggagacaagattgactgctagggtaatcatcagttactat 119  Q
    |||||||||||||||||| |||||||| |||||||||||||||||| |||||||||||||||||||  ||||||||| ||||||||||||||||||||||    
14178290 atgggggtttagcgtttggttgagactgttagggtttggggtttcagaataagaatcggaggagacgggattgactgttagggtaatcatcagttactat 14178191  T
120 tgtca-nnnnnnnnactactatttcttttttcaccctcactcctttcactcgccctactaaatttcaaaaatatcttcgtttgaattatataatctgaat 218  Q
    |||||         ||||||||||||||||||||||||||||||||||  |||||||||||||| |||||||||||||||||||||||||||||| ||||    
14178190 tgtcatttttttttactactatttcttttttcaccctcactcctttcatccgccctactaaattccaaaaatatcttcgtttgaattatataatccgaat 14178091  T
219 t 219  Q
    |    
14178090 t 14178090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 20 - 103
Target Start/End: Complemental strand, 14182154 - 14182071
Alignment:
20 atgggggtttagcgtttgattgagactcttagggtttggggtttcaaaataagaatcggaggagacaagattgactgctagggt 103  Q
    ||||| |||||  ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
14182154 atgggtgtttaatgtttgattgggactcttagggtttggggtttcaaaataagaatcggaggagacaggattgactgctagggt 14182071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University