View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3450_high_14 (Length: 264)
Name: NF3450_high_14
Description: NF3450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3450_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 248
Target Start/End: Complemental strand, 52003362 - 52003132
Alignment:
| Q |
18 |
cacagattcttggttcgtactataataatagtattgacactccatttatttctcaagaagactttccactgtccatgatgggagaagaagatcaaggttt |
117 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52003362 |
cacagattcttgattcgtactataataatagtattgacactccatttatttctcaagaagacttttcactgtccatgatgggagaagaagatcaaggttt |
52003263 |
T |
|
| Q |
118 |
gcttgatgatgagcttcagaatttggagctgcaaacaacatgtaaaatggagccaatacaatcacctgaaatgccagtagttttcaacactggtaatggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52003262 |
gcttgatgatgagcttcagaatttggagctgcaaacaacatgtaaaatggagccaatacaatcacctgaaatgccagtagttttcaacactggtaatggt |
52003163 |
T |
|
| Q |
218 |
atggaaagaaagaaccgatcgaagaaacttc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
52003162 |
atggaaagaaagaaccgatcgaagaaacttc |
52003132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University