View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3450_high_18 (Length: 249)
Name: NF3450_high_18
Description: NF3450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3450_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 243
Target Start/End: Original strand, 35293000 - 35293224
Alignment:
| Q |
18 |
gcaaggatttttatcacatcactatttgattcagttgacaatgatagacgtttttgcactcaataactcattgataccgacttcctcaaagtctctagtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35293000 |
gcaaggatttttatcacatcactatttgattcagttgacaatgatagacgtttttgcactcaataactcattgataccgacttcctcaaagtctctagtg |
35293099 |
T |
 |
| Q |
118 |
aatggcatttttaggaatttcattcctactagaatttaactttttaatgatacaaagtgtggattgtcaaaccaattgtgtgttatgtgatttccaactt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35293100 |
aatggcatttttaggaatttcattcctactagaatttaactttttaatgatac-aagtgtggattgtcaaaccaattgtgtgttatgtgatttccaactt |
35293198 |
T |
 |
| Q |
218 |
gaggattctctacgtgttcatttcag |
243 |
Q |
| |
|
|||||||||||||||||| ||||||| |
|
|
| T |
35293199 |
gaggattctctacgtgtttatttcag |
35293224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University