View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3450_high_4 (Length: 402)

Name: NF3450_high_4
Description: NF3450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3450_high_4
NF3450_high_4
[»] chr6 (4 HSPs)
chr6 (30-159)||(11397193-11397322)
chr6 (30-142)||(10732695-10732807)
chr6 (187-234)||(11397341-11397388)
chr6 (187-234)||(10732565-10732612)


Alignment Details
Target: chr6 (Bit Score: 118; Significance: 4e-60; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 30 - 159
Target Start/End: Original strand, 11397193 - 11397322
Alignment:
30 actagacgagaagaggaagaagctgaagcacggttaaccatgcaatttgctcaagaagcagctcatgctaaaatggctagagacttgagtaatgaggtat 129  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||    
11397193 actagacgagaagaggaagaagctgaagcacggttagccatgcaatttgctcaagaagcagctcatgctaaaatggctaaacacttgagtaatgaggtat 11397292  T
130 tcttgagggatttgagcattttaatatggg 159  Q
    ||||||||||||||||||||||||||||||    
11397293 tcttgagggatttgagcattttaatatggg 11397322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 30 - 142
Target Start/End: Complemental strand, 10732807 - 10732695
Alignment:
30 actagacgagaagaggaagaagctgaagcacggttaaccatgcaatttgctcaagaagcagctcatgctaaaatggctagagacttgagtaatgaggtat 129  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
10732807 actagacgagaagaggaagaagctgaagcacggttagccatgcaatttgctcaagaagcagttcatgctaaaatggctagagacttgagtaatgaggtat 10732708  T
130 tcttgagggattt 142  Q
    || | ||||||||    
10732707 tcgttagggattt 10732695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 11397341 - 11397388
Alignment:
187 gatgaagttgatttgcatttaaaagagcttcgggagatggttgttaaa 234  Q
    ||||||||||||||||||||| ||||||| ||||||||||||||||||    
11397341 gatgaagttgatttgcatttagaagagctccgggagatggttgttaaa 11397388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 10732612 - 10732565
Alignment:
187 gatgaagttgatttgcatttaaaagagcttcgggagatggttgttaaa 234  Q
    |||||||||||| | |||||| ||||||| ||||||||||||||||||    
10732612 gatgaagttgatgtacatttagaagagctccgggagatggttgttaaa 10732565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University