View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3450_high_6 (Length: 363)

Name: NF3450_high_6
Description: NF3450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3450_high_6
NF3450_high_6
[»] chr8 (2 HSPs)
chr8 (9-222)||(9422158-9422371)
chr8 (282-348)||(9422035-9422101)


Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 9 - 222
Target Start/End: Complemental strand, 9422371 - 9422158
Alignment:
9 agcagagacagagctatggagaatctctttagcaacatctggattgcaagtaactatggctcttgtgtcaccaagactaaaagccatgagtcttgttgct 108  Q
    |||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
9422371 agcaaagacagagctatggagaatttctttagcaacatctggattgcaagtaaccatggctcttgtgtcaccaagactaaaagccatgagtcttgttgct 9422272  T
109 ttgcatgtttttgctgtggaagctatacggtggtgtgctagtgatgaagacataagattcatgcttccaaatagaggatacccttttggaccaggaatga 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9422271 ttgcatgtttttgctgtggaagctatacggtggtgtgctagtgatgaagacataagattcatgcttccaaatagaggatacccttttggaccaggaatga 9422172  T
209 atattgaagaggaa 222  Q
    ||||||||||||||    
9422171 atattgaagaggaa 9422158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 282 - 348
Target Start/End: Complemental strand, 9422101 - 9422035
Alignment:
282 ggtggaatagttagaggaataatagtacttgccccaagcaggaccaccagggtgagaccaataaaag 348  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9422101 ggtggaatagttagaggaataatagtacttgccccaagcaggaccaccagggtgagaccaataaaag 9422035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University