View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3450_high_6 (Length: 363)
Name: NF3450_high_6
Description: NF3450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3450_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 9 - 222
Target Start/End: Complemental strand, 9422371 - 9422158
Alignment:
| Q |
9 |
agcagagacagagctatggagaatctctttagcaacatctggattgcaagtaactatggctcttgtgtcaccaagactaaaagccatgagtcttgttgct |
108 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9422371 |
agcaaagacagagctatggagaatttctttagcaacatctggattgcaagtaaccatggctcttgtgtcaccaagactaaaagccatgagtcttgttgct |
9422272 |
T |
|
| Q |
109 |
ttgcatgtttttgctgtggaagctatacggtggtgtgctagtgatgaagacataagattcatgcttccaaatagaggatacccttttggaccaggaatga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9422271 |
ttgcatgtttttgctgtggaagctatacggtggtgtgctagtgatgaagacataagattcatgcttccaaatagaggatacccttttggaccaggaatga |
9422172 |
T |
|
| Q |
209 |
atattgaagaggaa |
222 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
9422171 |
atattgaagaggaa |
9422158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 282 - 348
Target Start/End: Complemental strand, 9422101 - 9422035
Alignment:
| Q |
282 |
ggtggaatagttagaggaataatagtacttgccccaagcaggaccaccagggtgagaccaataaaag |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9422101 |
ggtggaatagttagaggaataatagtacttgccccaagcaggaccaccagggtgagaccaataaaag |
9422035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University