View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3450_high_7 (Length: 353)
Name: NF3450_high_7
Description: NF3450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3450_high_7 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 45 - 353
Target Start/End: Complemental strand, 13715391 - 13715083
Alignment:
| Q |
45 |
attatttgggttgaacaaaacaaacaacgcttttccaatgagaacaattccatgcaaagcctttttcacaagcttatttatgaagttcatcttagttgca |
144 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13715391 |
attatttgggttgaacaaaacagacaacgcttttccaatgagaacaattccatgcaaagcctttttcacaagcttatttatgaagttcatcttagctgca |
13715292 |
T |
 |
| Q |
145 |
atcttattaaaggtcgtggttcatcttc--tatggtagatttttgtgttacccaactgttcaaaacctcttgcagtgcgtctattcctcactcgtttttt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13715291 |
atcttattaaaggtcgtggttcatcttctatatggtagacttttgtgttacccaactgttcaaaacctcttgcagtgcgtctattccttactcgtttttt |
13715192 |
T |
 |
| Q |
243 |
gaagttgtttggccccctccttgcccggttgggtcaagtttaacctggatggatctatggtggctaannnnnnnaagtttgccactattggaattgcttg |
342 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||| ||||||||||||||||||| ||| ||| ||| ||||||||||||||||| |
|
|
| T |
13715191 |
gaagttgtttggtcccctccttgcctggttgggtcaagtttaatctggatggatctatggtgggtaacccccc--agtctgctactattggaattgcttg |
13715094 |
T |
 |
| Q |
343 |
tagagatagta |
353 |
Q |
| |
|
||||||||||| |
|
|
| T |
13715093 |
tagagatagta |
13715083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University