View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3450_high_9 (Length: 340)
Name: NF3450_high_9
Description: NF3450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3450_high_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 53; Significance: 2e-21; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 265 - 329
Target Start/End: Complemental strand, 31037022 - 31036958
Alignment:
| Q |
265 |
aaggcaccacacaagctttaagaaacttgaccaatccttaatgtcacataatccaactttgtctc |
329 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
31037022 |
aaggtaccacacaagctttaagaaacttgaccaaaccttaatgtcaaataatccaactttgtctc |
31036958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 31 - 89
Target Start/End: Complemental strand, 31037151 - 31037093
Alignment:
| Q |
31 |
gtatagttatctttaagaaggaagaaaatagagctgagtgagaatgttcaaaaaggaat |
89 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31037151 |
gtattgttatctttaagaaggaagaaaatagagctgagagagaatgttcaaaaaggaat |
31037093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 166 - 236
Target Start/End: Complemental strand, 31074289 - 31074219
Alignment:
| Q |
166 |
tgatgtatgctcaaaagaaacttgattcaatttcaatactagtgctcgaaatacttcggttgtctaatgtt |
236 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||| | ||||| ||||| |||| || ||||||||| |
|
|
| T |
31074289 |
tgatgtgtgctcaaaagaaacttaatttaatttcaataccaatgctcaaaataattcgattctctaatgtt |
31074219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University