View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3450_low_21 (Length: 228)
Name: NF3450_low_21
Description: NF3450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3450_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 19 - 209
Target Start/End: Original strand, 8019046 - 8019236
Alignment:
| Q |
19 |
atgcaaacaagaaatatgcagcttcaatgaagagtcaaccttgtactcgatagacaactcagcctcaactgaagcattcaacataacattcataccttca |
118 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8019046 |
atgcaaacaagaaatatgcaacttcaatgaagagtcaaccttgtgctcgatagacagctcagcctcaactgaaacattcaacataacattcataccttca |
8019145 |
T |
 |
| Q |
119 |
aaacaccaatnnnnnnnnnnnncaataagaaattatcgtcttggtgcaacctcatctcaatttaaattcatcggttagattaccatttact |
209 |
Q |
| |
|
||||||| || ||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8019146 |
aaacaccgataaaaaacaaaaacaataagaaatgatcgtcttgctgcaacctcatctcaatttaaattcatcggttagattaccatttact |
8019236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University