View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3450_low_4 (Length: 402)
Name: NF3450_low_4
Description: NF3450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3450_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 4e-60; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 30 - 159
Target Start/End: Original strand, 11397193 - 11397322
Alignment:
| Q |
30 |
actagacgagaagaggaagaagctgaagcacggttaaccatgcaatttgctcaagaagcagctcatgctaaaatggctagagacttgagtaatgaggtat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
11397193 |
actagacgagaagaggaagaagctgaagcacggttagccatgcaatttgctcaagaagcagctcatgctaaaatggctaaacacttgagtaatgaggtat |
11397292 |
T |
 |
| Q |
130 |
tcttgagggatttgagcattttaatatggg |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
11397293 |
tcttgagggatttgagcattttaatatggg |
11397322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 30 - 142
Target Start/End: Complemental strand, 10732807 - 10732695
Alignment:
| Q |
30 |
actagacgagaagaggaagaagctgaagcacggttaaccatgcaatttgctcaagaagcagctcatgctaaaatggctagagacttgagtaatgaggtat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10732807 |
actagacgagaagaggaagaagctgaagcacggttagccatgcaatttgctcaagaagcagttcatgctaaaatggctagagacttgagtaatgaggtat |
10732708 |
T |
 |
| Q |
130 |
tcttgagggattt |
142 |
Q |
| |
|
|| | |||||||| |
|
|
| T |
10732707 |
tcgttagggattt |
10732695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 11397341 - 11397388
Alignment:
| Q |
187 |
gatgaagttgatttgcatttaaaagagcttcgggagatggttgttaaa |
234 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
11397341 |
gatgaagttgatttgcatttagaagagctccgggagatggttgttaaa |
11397388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 10732612 - 10732565
Alignment:
| Q |
187 |
gatgaagttgatttgcatttaaaagagcttcgggagatggttgttaaa |
234 |
Q |
| |
|
|||||||||||| | |||||| ||||||| |||||||||||||||||| |
|
|
| T |
10732612 |
gatgaagttgatgtacatttagaagagctccgggagatggttgttaaa |
10732565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University