View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3451_high_8 (Length: 202)
Name: NF3451_high_8
Description: NF3451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3451_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 11 - 186
Target Start/End: Complemental strand, 37135620 - 37135445
Alignment:
| Q |
11 |
agcagagataccggagacagcatacgacaaaacaacggcaggaccagcctcctcacgagcttcaagaccggtgagaacaaaaatgccggaaccgacaact |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37135620 |
agcagagataccggagacagcatacgacaaaacaacggcaggaccagcctcctcacgagcttcaagaccggtgagaacaaaaatgccggaaccgacaact |
37135521 |
T |
|
| Q |
111 |
gcaccgattccgaaccaaataagatcccaaccattcagagttttcttcatttggtggctgcttctagctttcatct |
186 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37135520 |
gcgccgattccgaaccaaataagatcccaaccattcagagttttcttcatttggtggctgcttctagctttcatct |
37135445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University