View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3455_high_16 (Length: 363)
Name: NF3455_high_16
Description: NF3455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3455_high_16 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 338; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 18 - 363
Target Start/End: Complemental strand, 48606211 - 48605866
Alignment:
| Q |
18 |
agaaggtttgaagcttaccccttggaaatatgtttacgaacgaatggttcgtagtattgcaattagattctacaagaatgaggttttcataccggagttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48606211 |
agaaggtttgaagcttaccccttggaaatatgtttacgaccgaatggttcgtagtattgcaattagattctacaagaatgaggttctcataccggagttg |
48606112 |
T |
|
| Q |
118 |
caaacttgcaaggctgctgattttgaaagggatgtttggtgtggaaggtggacaaggcatggcaagaatgacgactgctccattggtgatgatggtagat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48606111 |
caaacttgcaaggctgctgattttgaaagggatgtttggtgtggaaggtggacaaggcatggcaagaatgacgactgctccattggtgatgatggtagat |
48606012 |
T |
|
| Q |
218 |
acagatgcctagcaccagattttccttgcaaatctccttggtgtgatggttccttgggagttttggagagtaatggttgggtgtactcgacacattgctc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48606011 |
acagatgcctagcaccagattttccttgcaaatctccttggtgtgatggttccttgggagttttggagagtaatggttgggtgtactcgacacattgctc |
48605912 |
T |
|
| Q |
318 |
gttcaagatgtattcagctgagtctgcttggaattgcttgaagaat |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48605911 |
gttcaagatgtattcagctgagtctgcttggaattgcttgaagaat |
48605866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 19 - 363
Target Start/End: Complemental strand, 48611806 - 48611462
Alignment:
| Q |
19 |
gaaggtttgaagcttaccccttggaaatatgtttacgaacgaatggttcgtagtattgcaattagattctacaagaatgaggttttcataccggagttgc |
118 |
Q |
| |
|
|||||||||||| |||| || |||| || ||||||||| |||||||||||||||||||||||||||||||| ||| |||| |||| ||||||||| ||| |
|
|
| T |
48611806 |
gaaggtttgaagtttactccatggagatttgtttacgatcgaatggttcgtagtattgcaattagattctataaggatgatattttgataccggagctgc |
48611707 |
T |
|
| Q |
119 |
aaacttgcaaggctgctgattttgaaagggatgtttggtgtggaaggtggacaaggcatggcaagaatgacgactgctccattggtgatgatggtagata |
218 |
Q |
| |
|
| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| ||||||| |||| |||||||| |
|
|
| T |
48611706 |
agagttgcaaggctgctgattttgaaagggatgtttggtgtggaaggtggacaaggcatggcaggaatgatgactgtgtcattggtaatgacggtagata |
48611607 |
T |
|
| Q |
219 |
cagatgcctagcaccagattttccttgcaaatctccttggtgtgatggttccttgggagttttggagagtaatggttgggtgtactcgacacattgctcg |
318 |
Q |
| |
|
| ||||||||||| ||||||||||||||||||| |||||||||||||| || |||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48611606 |
ccgatgcctagcatggaattttccttgcaaatctccctggtgtgatggttcattaggagctttggagagtaatggttgggtgtactcgacgcattgctca |
48611507 |
T |
|
| Q |
319 |
ttcaagatgtattcagctgagtctgcttggaattgcttgaagaat |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48611506 |
ttcaagatgtattcagctgagtctgcttggaattgcttgaagaat |
48611462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University