View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3455_high_23 (Length: 277)
Name: NF3455_high_23
Description: NF3455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3455_high_23 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 273; Significance: 1e-153; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 273; E-Value: 1e-153
Query Start/End: Original strand, 1 - 277
Target Start/End: Complemental strand, 47105548 - 47105272
Alignment:
| Q |
1 |
aaggctaccctatccttacctttggtgaacaaaccattgcatcacagttaccattcacctacgaaccgtttaaacattctttgaacaaaagaaatattaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47105548 |
aaggctaccctatccttacctttggtgaacaaaccattgcatcacagttaccattcacctacgaaccgtttaaacattctttgaacaaaagaaatattaa |
47105449 |
T |
|
| Q |
101 |
catctctaatgttttatgtgctgcttttacggtaggttggtttggagaggaaaagagtaaacgaacagtgaaagtgaagtgttattacaagaatggttct |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47105448 |
catttctaatgttttatgtgctgcttttacggtaggttggtttggagaggaaaagagtaaacgaacagtgaaagtgaagtgttattacaagaatggttct |
47105349 |
T |
|
| Q |
201 |
gctaatttgtatgcaagaccattggagggtgtggcagctgtggttgatcttgatgaaatgaagattgttggttactc |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47105348 |
gctaatttgtatgcaagaccattggagggtgtggcagctgtggttgatcttgatgaaatgaagattgttggttactc |
47105272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University