View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3455_high_24 (Length: 251)
Name: NF3455_high_24
Description: NF3455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3455_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 90 - 210
Target Start/End: Complemental strand, 30965138 - 30965018
Alignment:
| Q |
90 |
ctatcacatgctcggaaaattctataaaaatcgtaaataatcnnnnnnnnnnnnnnnaaggaacgaatctttttcatataacaggctaagatattgtcaa |
189 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30965138 |
ctatcacatgcttggaaaattctataaaaatcgtaaagaatctttttcattttttttaaggaacgaatctttttcatataacaggctaagatattgtcaa |
30965039 |
T |
|
| Q |
190 |
aaaaatataacaatcagagat |
210 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
30965038 |
aaaaatataacaaccagagat |
30965018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 30965233 - 30965161
Alignment:
| Q |
1 |
tttcttaataaaaaatcaatcaaattattac-------atcccgtgaaaataaaactatcacataccttccct |
66 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30965233 |
tttcttaataaaaaataaatcgaattattacgtagtatatcccgtgaaaataaaactatcacataccttccct |
30965161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University