View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3455_high_26 (Length: 250)
Name: NF3455_high_26
Description: NF3455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3455_high_26 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 117 - 250
Target Start/End: Complemental strand, 6435677 - 6435544
Alignment:
| Q |
117 |
ctaaatttggaaaagtatagatagaactcttgatgagggttcatacgaggattacttttcatcttataagtcgatttgtaatgaggagttagatttaaaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6435677 |
ctaaatttggaaaagtatagatagaactcttgatgagggtttatacgaggagtacttttcatcttataagtcgatttgtaacgaggagttagatttaaaa |
6435578 |
T |
|
| Q |
217 |
tttcaacaattatcggggcttattgatcaggcta |
250 |
Q |
| |
|
|||||| | ||||| | ||||||||||||||||| |
|
|
| T |
6435577 |
tttcaatagttatcagagcttattgatcaggcta |
6435544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University