View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3455_low_37 (Length: 208)
Name: NF3455_low_37
Description: NF3455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3455_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 40720710 - 40720518
Alignment:
| Q |
1 |
gaatactaggtaaggatgttccttttcggatatagacgtgtagcattaaggatgnnnnnnnn-aggatataagagtaaaaatgttctattttatagatat |
99 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40720710 |
gaatactaggtaaggatgttctttttcggatatagatgtatagcattaaggatgtttttttttaggatataagagtaaaaatgttctattttatagatat |
40720611 |
T |
 |
| Q |
100 |
atgtaattgactaaacaatgatgttttgttttttgagatatacttgtacannnnnnngaaggatgagatatatcatacatataattgattaat |
192 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| || | |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40720610 |
atgtaattgactaaacaatgatgttctgttttttgagatatacttataaatttttttgaaggatgagatatattatacatataattgattaat |
40720518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University