View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3456_high_5 (Length: 250)
Name: NF3456_high_5
Description: NF3456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3456_high_5 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 16897130 - 16897374
Alignment:
| Q |
13 |
aatatgcattatgctttgcaacatcatgtcattgagtatatcttatctagagctgaaaacataaatttccattccaatttcaacataaaaataagcttaa |
112 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16897130 |
aatatgcaatatgctttgcaacatcatgtcattgagtatatct-----agagctgaaaacataaatttccattccaatttcaacataaaaataagcttaa |
16897224 |
T |
 |
| Q |
113 |
caactatagtcatatta------------agagactaattgatatttgttctcaccaacatacctgagtctgtggactcatctgatctaccaatagctct |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16897225 |
caactatagtcatattattacacgctgaaagagactaattgatattcgttctcaccaacatacctgagtctgtggactcatctgatctaccaatagctct |
16897324 |
T |
 |
| Q |
201 |
gatataaaaattcttggcaacggaccattcatgccgctgccactgccaga |
250 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
16897325 |
gatataaaaattcttggcaagggaccattcatgccactgccactgccaga |
16897374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University