View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3456_low_8 (Length: 227)
Name: NF3456_low_8
Description: NF3456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3456_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 32429647 - 32429849
Alignment:
| Q |
1 |
ccctttgatccacgacgggtgccaaatattgtgaattcaaactcaaatcgcaccaacgacttagatgtgtgggacaaatatcaattgcaaccaataacca |
100 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32429647 |
ccctttaatccacgacgagtgccaaatattgtgaattcaaactcaaatcacaccaacgacttagatgtgtgggacaaatatcaattgcaaccaataacca |
32429746 |
T |
|
| Q |
101 |
agaaatctcaaccaacaacaacaagtctagtaactaaggaaaacaaagatcaaagataagaaagtagaggaatgaatacaatttgtcccagtatgaccta |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32429747 |
agaaatcgcaaccaacaacaacaagtctagtaactaaggaaaacaaagatcaaagataagaaagtagaggaatgaatacaatttgt-ccagtatgaccta |
32429845 |
T |
|
| Q |
201 |
tgtt |
204 |
Q |
| |
|
|||| |
|
|
| T |
32429846 |
tgtt |
32429849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 61 - 101
Target Start/End: Complemental strand, 1683808 - 1683768
Alignment:
| Q |
61 |
ttagatgtgtgggacaaatatcaattgcaaccaataaccaa |
101 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
1683808 |
ttagatgtgtgggacaaacatcaatgacaaccaataaccaa |
1683768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University